DNA Sentence

GCCTTGTACCACTAAGCTAGGTGGATGCCCATCACT

Alfred Russel Wallace

I choose Alfred Russel Wallace because he kind of worked hand in hand with Charles Darwin. I feel If Wallace had not been there so they can motivate each other with there work then his ideas could have been different. Both Wallace and Darwin found inspiration in a book by Thomas Malthus Principles of Population 1797 where they were inspired by the idea of population growth. It then occurred to both of them that plants and animals would be experiencing the pressures of population growth as well. The only way that they could survive is if they had favorable traits that helped them do so. Darwin called that process Natural Selection. Wallace supplied birds for Darwin to help in his studies of Natural Selection when he went on a trip to South America and Asia. In 1858 Wallace sent Darwin his work which was almost just like Darwin’s. So Darwin finally ended up publishing his book The Origin of Species in 1959. If Wallace and Darwin had never heard of each other Darwin might not have been motivated to publish his findings. I think he feared what the church might have thought of them. But with Wallace and his ideas following so close behind he had to take credit for his ideas right away. So I would say Alfred Russel Wallace had a pretty big influence on Darwin. (http://evolution.berkeley.edu/evolibrary/article/history_14)