Human Variation

1. High levels of solar radiation negatively impact the survival of humans because it affects human food sources like crops and love stock. They might not be able to survive the higher levels of radiation. It makes it harder for people to keep there core body temp down to 98.6 F because the increase in heat.
2.  

Short term	Facultative	Developmental	Cultural
squinting to protect eyes from sun.	increased melatonin production in skin. making skin darker to protect from sun.	Natural selection favoring more slender bodies that retain less heat. Bipedal walking less surface area for radiation.	Technology, clothing, housing, sunblock, umbrellas

3. The benefits is that we get to learn why people developed the traits they have and what we can do to adapt to our changing environment better.
4. People who live in areas where solar radiation is stronger like tropical area would have darker skin to protect themselves from the radiation. The study of environmental influences on adaptations is a better way of understanding human variation because “race” does not categorize people into groups with similar variation to study the way a groups environment influence their traits would be a better method because that’s how one would learn how they have adapted to that environment. For example you can learn that as a result of radiation in Africa the people are darker to adapt. Or maybe it was “sexual selection” as some scientists think it is. Another example would be head shape; you can really infer that this “race” has this head shape because it varies. 



Short-term









Facultative

5.  

Developmental



Cultural

Communication Experiment

            This experiment was difficult because it was hard to get out of a habit of something your use to doing for millions of years! When I wasn’t able to speak and only communicate with had gestures and facial expressions my partners in the experiment would start to exaggerate they own facial expressions and hand gestures as well to try to understand what I was saying better. I also wasn’t able to communicate complex ideas. The only things I could communicate were things like thirsty, sit-down and look that way, just simple things like that. The group that communicates only by hand gesture wouldn’t be able to communicate something like how cell division works just by using symbols.

            I have learned that both forms of communication are just as important as the other. Someone who is only able to talk by not using hand or facial gestures to communicate would probably find it very hard to communicate with someone else that is only able to communicate with facial gestures because its part of communicating and understanding each other. Especially if someone travels to another country where they do not speak there language they have to find universal “words”  for things like food for example, pointing to your mouth is like saying “hungry” or “food” in all languages.

            People in our culture that have difficulty speaking out language are foreigners and maybe some animals such as dogs and cats. I have already explained how people have to communicate with someone who doesn’t speak the same language but a dog for example, they communicate through body language and facial expressions. They read how your body language and facial expression is to be able to know how your feeling and what you want to say to them. If you’re standing straight up tall with your head up straight they think “This guys boss”. If you’re hunched over crying they can understand that your sad and communicate with you to make you feel better by licking your face and giving you a sad expression back. I was just watching an interesting video by Amy Cuddy called “Your Body Language Shapes Who You Are” where she talks about “power posing”. Everyone might be interested in watching because she talks about how your body pose actually changes how you feel on the inside and how people around you read your body language. She encourages everyone to try power posing and test the effects it has on ones self and others around. If the person standing next to them is in the “dominant pose” this being arms and legs spread out very confidently, then the other person automatically hunches and assumes the “submissive pose”.

            I found the experiment where we had to talk for 15 minutes but not use gestures to be the most difficult one out of the two because I had a really hard time concentrating on what I was trying to say. I found that facial expressions and hand gestures help push the conversation along. My boyfriend that I did the experiment, and I think he was effected also in the same way I was because he wasn’t able to follow what I was saying either. Signs in our language play as much of a roll in communicating as actually speaking words does. I was very surprised about the results about the second half of the experiment because not being able to use hand gesture and facial expressions to communicate made it so I wasn’t able to talk so liberally and fluently like we do. Communicating without using words wasn’t as mentally difficult then communicating without using body language; I found it to be more fun.  It seems that body language is sort of a universal language that people and animals are born knowing. Human babies start to learn to talk using a lot of body language at first. People with mutated language genes might have problems reading and communicating body language.

Amy Cuddy video only like 11 minutes if you are interested in watching. http://www.ted.com/talks/amy_cuddy_your_body_language_shapes_who_you_are

Reference

National Geographic Society, Date Accessed July 29, 2014, Neandertals Had Same “Language Gene” as Modern Humans

Piltdown Man

The Piltdown Man

Fifty years after Darwins publication of The Origins of Species there was still no evidence of humans and apes being related. In Germany bones that resembled humans had been found that they named them Neanderthal, shortly after they found remains in France and Spain as well. The British were annoyed that they had not discovered anything. Then in 1912 Charles Dawson and Arthur Smith Woodward introduced what was nicknamed "the earliest Englishman” ("The Boldest Hoax." N.p., n.d. Web) also known as Piltdown man. “It was the proof of Darwin's theory” ("The Boldest Hoax." N.p., n.d. Web.).

            Charles Dawson was an armature archeologist who first discovered the Piltdown man in Piltdown, England. Dawson was digging in a gravel pit and claimed to have found a piece of an ancient human skull. He then invited Arthur Smith Woodward a leading geologist and a French paleontologist to join him in his dig where they found other ancient pieces such as stone tools and animal bones that implied that the site was more than a million years old. After Dawson’s death in 1916 no more fossils were found.

            The Piltdown man had a huge impact on the scientific community as it lead scientist down the wrong path. It favored Dawsons and a man named Arthur Keith’s idea that the humans brain size had evolved before they evolved there upright position. For the next decade the Piltdown man dominated research and then in 1920 ancient remains were found in Asia and Africa that dated 100,000 years after the Piltdown man, but the skull looked less human not more with a bigger brain size.

            The Piltdown man Hoax was discovered after World War 2 when new tests were developed that you can date by testing the fluorine content, the Piltdown man turned out to date just from 100,000 years ago. Furthermore in 1953 the first set of full tests were conducted proving that the jawbone was less than 300 years old and it was in fact from a female orangutan. A piece of the front jaw had been broken off that gave away big clues that it was an ape jaw bone piece. Also the teeth had been filed down to look flatter like human molars and the canines had been filed down as well showing still the texture from where they filed them.

            The human faults that came into play were that everyone suspected that the Piltdown man was a hoax but people were too afraid to say anything. There ego also got in the way from being honest about things because they wanted to believe that England was a place where humans inhabited millions of years ago. The Natural History museum allowed very few outsiders to view the artifacts, which raised speculation if the pieces had been forged. There could have been more examination to the pieces maybe even comparing them to other ape jaw bone pieces. People had been saying that the pieces looked at if they didn’t belong together. With this false information on the evolution of humans, scientists were lead down the wrong path as to how humans evolved. Scientist were lead to believe that the brain size evolved before bipedal walking in humans. This also confused scientist when they later found a real hominine fossil and were confused to where it fit because it dated after the Piltdown man fossil yet the size of the skull was much smaller.

            I don’t feel like it would be possible to remove the human factor from science. It’s not something that can really be done without people. We need scientists thinking out side the box to come up with new ideas. Removing humans from a situation like this would not reduce the chances of error. Not jumping to conclusion and accepting the first thing you hear because it might be what you want to believe would make a difference. The life lesson that I learned from this article was to form my own opinions on things and not assume what’s right because someone says so.

              

Comparative Primate

All of these primates really mostly on vision for finding food as opposed to olfaction. They all have their eyes on the front of their face; this allows them to be able to have color vision and stereoscopic vision (Depth perception).

Lemur:

There environment, they at one point lived in tropical areas of the earth but today they are only found in Europe, Asia, and Africa. Some species are only arboreal and other larger species spend half there time in trees and the other half on the ground.

Their body size, they range in sizes from a small to a large domestic cat.

Sexual Dimorphism: males usually increase in body mass and testes by 100% before mating season.

Primate traits in environment: The male’s lemur has to compete with other males for a mate so there body mass increases because of competition. They are herbivorous so there sense of smell is increased compared to other primate’s maybe so they are better able to find fruits.

Chimpanzee:

Our closest relatives

There environment: Because of deforestation chimpanzees live in patches of what’s left over of rainforests. They are mostly found on the equatorial belt from the Atlantic Ocean to Lake Tangayika but can also be found in bamboo forest, swamp forests, and the savanna area because they are very adaptive. They spend a lot of their time in trees where they sleep eat and hang out.

Their body size: They can grow to be 4 to 5.5 ft and weigh from 70 to 150 pounds.

Sexual Dimorphism: Females reach reproductive age at 13 while males are not adults till they are 16. There sexual dimorphism is not as pronounced as other primates, with males weighing about 150 pounds and females 100 pounds.

Traits in environment: Chimpanzees live in forest areas where they are able to find fruits, seeds, and insects that their diets consist most of.

 

Baboons:

There environment: All baboon species live in Africa or Arabia. They usually prefer to live in the savannah and some live in tropical forests.

Their body size: They can grow from 50 to 100 pounds and their bodies are twenty to forty inches long. They all have long muzzles and heavy powerful jaws.

Sexual Dimorphism: Baboons have strong sexual dimorphism males are bigger than females, bigger canines, and males also have a mane. Sometimes male and female baboons are different colors as well.

Traits in environment: Baboons spend much of their time on the ground but go up into trees to sleep, eat, or be on the look out. They eat just about anything they can get their hands. They are sometimes considered pests because they eat farmer’s crops!

 

Gibbons

Their environment: Gibbons are strictly arboreal and live in the dense forest of southern Asia. There are species that are found ranging from northeaster India to southern China.

Their body size: Gibbons weigh from nine to twenty nine pounds and grow from 17inches to 25inches.

Sexual Dimorphism: Males and females are very similar. Some gibbons show sexual dimorphism through the color of their fur. Both the males and female are very territorial and defend their territory with whoops and songs. Males are very involved in taking care of their child. My boyfriend can learn a thing from them.

Traits in environment: Because Gibbons spend most of their time in trees they are the most knows for their acrobatic brachiating. They feed mostly on fruits, their favorite being figs! What I thought was very cool was the gibbons have a ball and socket joint in there wrist. This allows them to use less energy because they don’t have to move as much.

 

Spider Monkey

Their environment: Spider monkeys live in Central, South America and Mexico. They live primarily in evergreen rainforest but also inhabit semi deciduous and mangrove forest.

Their body size: They grow from fourteen to twenty-six inches and weigh from 13 to 25 pounds.

Sexual Dimorphism: Males sexually mature at five and females at 4. There born black as babies and as pre-adults change color. Females give birth to one baby every 2 to 4 years. Sexual dimorphism is not very prominent with just the males being slightly larger.

Traits in environment: Adoptions to their environment is that they do not have opposable thumbs because they do not need them to move about trees. They also have a tail that grips and they can also use to move from branches. They live in trees because they eat mostly fruits and seeds.

Over all I have found that the diet of all primates is mostly the same. They all eat fruits and seeds with some that also eat insects and small mammals. They live in almost the same type of environment, mostly tropical with lost of trees and plants. Because they live where there are so many trees some have adapted to living mostly in the trees where they are safe from predators and are able to find more fruits. They all had opposable thumbs that they use for picking at insects except for the spider monkey that has evolved without them to be able to swing form trees better and for this reason also has evolved a tail with griping pads.

Sources:

http://anthro.palomar.edu/primate/prim_4.htm

http://library.sandiegozoo.org/factsheets/ringtailed_lemur/lemur.htm

http://animals.nationalgeographic.com/animals/mammals/chimpanzee/

http://www.janegoodall.org

http://animals.nationalgeographic.com

Homologus and Analogous

Frogs (amphibians) and alligators (reptiles) are both animals that posses homologous traits. Homologous traits are traits that are shared between two different species but they share a comment ancestor. Both frogs and alligators have similar bones in similar positions like their bones in their hands and they both breathe out of water but can hold there breaths for long periods of time under water. There arm bones and back bones are positioned differently probably because the different paths they took in evolution. Alligators are big and arms are positioned to be able to push there weight along. Frogs are small and their arms are positioned to jump freely out of harms way. This is just my hypothesis on why there arms might have evolved differently from each other. Frogs backbones are also shaped to enhance their ability to jump where as alligators are positioned straight so they can swim fast through water. The common ancestor frogs and alligators shared was the tetra-pods, “Fish out of water” (http://dinosaurs.about.com/od/otherprehistoriclife/a/tetrapods.htm) In prehistoric times tetra pods were the first fishes’ to crawl out of water and make their way on land to start breathing air. Then they evolved from there into amphibians and reptiles.

Fun fact I read online amphibians 300 million years ago grew up to 15 feet long

 (about.com).


An example of analogous traits would be in hummingbird wings and butterfly wings. They both use there wings for flying but there structures are completely different. Hummingbird wings are made of forelimbs while butterfly wings are not, because butterflies are bugs. Hummingbirds evolved from reptiles while butterflies evolved from other bugs or arthropods.

                                                           

DNA Sentence

GCCTTGTACCACTAAGCTAGGTGGATGCCCATCACT

Alfred Russel Wallace

I choose Alfred Russel Wallace because he kind of worked hand in hand with Charles Darwin. I feel If Wallace had not been there so they can motivate each other with there work then his ideas could have been different. Both Wallace and Darwin found inspiration in a book by Thomas Malthus Principles of Population 1797 where they were inspired by the idea of population growth. It then occurred to both of them that plants and animals would be experiencing the pressures of population growth as well. The only way that they could survive is if they had favorable traits that helped them do so. Darwin called that process Natural Selection. Wallace supplied birds for Darwin to help in his studies of Natural Selection when he went on a trip to South America and Asia. In 1858 Wallace sent Darwin his work which was almost just like Darwin’s. So Darwin finally ended up publishing his book The Origin of Species in 1959. If Wallace and Darwin had never heard of each other Darwin might not have been motivated to publish his findings. I think he feared what the church might have thought of them. But with Wallace and his ideas following so close behind he had to take credit for his ideas right away. So I would say Alfred Russel Wallace had a pretty big influence on Darwin. (http://evolution.berkeley.edu/evolibrary/article/history_14)